mouse apoe Search Results


mouse apoe  (Elabscience Biotechnology)
93
Elabscience Biotechnology mouse apoe
Mouse Apoe, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+apoe/pm28546220-246-0-17?v=Elabscience+Biotechnology
Average 93 stars, based on 1 article reviews
mouse apoe - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
nm 009696  (OriGene)
90
OriGene nm 009696
Nm 009696, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+apoe/pmc03755106-234-14-12?v=OriGene
Average 90 stars, based on 1 article reviews
nm 009696 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
qpcr primer apoe fw gaaccgcttctgggattacctg rev gcctttacttccgtcatagtgtc  (OriGene)
94
OriGene qpcr primer apoe fw gaaccgcttctgggattacctg rev gcctttacttccgtcatagtgtc
(A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( <t>Apoe</t> ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).
Qpcr Primer Apoe Fw Gaaccgcttctgggattacctg Rev Gcctttacttccgtcatagtgtc, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+apoe/pmc13155197-92-0-9?v=OriGene
Average 94 stars, based on 1 article reviews
qpcr primer apoe fw gaaccgcttctgggattacctg rev gcctttacttccgtcatagtgtc - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier
mouse apoe cat no bp2046 antibody  (OriGene)
90
OriGene mouse apoe cat no bp2046 antibody
(A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( <t>Apoe</t> ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).
Mouse Apoe Cat No Bp2046 Antibody, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+apoe/pmc05371326-65-18-25?v=OriGene
Average 90 stars, based on 1 article reviews
mouse apoe cat no bp2046 antibody - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
apolipoprotein e  (OriGene)
90
OriGene apolipoprotein e
(A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( <t>Apoe</t> ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).
Apolipoprotein E, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+apoe/pm28197637-27-0-16?v=OriGene
Average 90 stars, based on 1 article reviews
apolipoprotein e - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
mouse monoclonal anti apoe  (OriGene)
90
OriGene mouse monoclonal anti apoe
(A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( <t>Apoe</t> ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).
Mouse Monoclonal Anti Apoe, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+apoe/pm23372804-214-26-29?v=OriGene
Average 90 stars, based on 1 article reviews
mouse monoclonal anti apoe - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
anti apo e  (OriGene)
90
OriGene anti apo e
(A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( <t>Apoe</t> ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).
Anti Apo E, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+apoe/pmc08479258-95-7-10?v=OriGene
Average 90 stars, based on 1 article reviews
anti apo e - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
mc208139 pcmv6 entry mammalian expression vector origene ps10001 paav d377y mpcsk9 cis plasmid addgene  (OriGene)
91
OriGene mc208139 pcmv6 entry mammalian expression vector origene ps10001 paav d377y mpcsk9 cis plasmid addgene
(A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( <t>Apoe</t> ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).
Mc208139 Pcmv6 Entry Mammalian Expression Vector Origene Ps10001 Paav D377y Mpcsk9 Cis Plasmid Addgene, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+apoe/pm37824329-320-12-17?v=OriGene
Average 91 stars, based on 1 article reviews
mc208139 pcmv6 entry mammalian expression vector origene ps10001 paav d377y mpcsk9 cis plasmid addgene - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier
resource source identifier recombinant dna apoe mouse untagged  (OriGene)
91
OriGene resource source identifier recombinant dna apoe mouse untagged
(A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( <t>Apoe</t> ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).
Resource Source Identifier Recombinant Dna Apoe Mouse Untagged, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+apoe/pm37824329-320-2-11?v=OriGene
Average 91 stars, based on 1 article reviews
resource source identifier recombinant dna apoe mouse untagged - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier
mouse apoe  (Novus Biologicals)
86
Novus Biologicals mouse apoe
(A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( <t>Apoe</t> ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).
Mouse Apoe, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+apoe/pm24345162-82-11-16?v=Novus+Biologicals
Average 86 stars, based on 1 article reviews
mouse apoe - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

Image Search Results


(A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( Apoe ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).

Journal: Cell reports

Article Title: Aging disrupts sympathetic innervation of the thymus

doi: 10.1016/j.celrep.2026.117126

Figure Lengend Snippet: (A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( Apoe ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).

Article Snippet: qPCR Primer – Apoe FW: GAACCGCTTCTGGGATTACCTG Rev: GCCTTTACTTCCGTCATAGTGTC , Origene , SKU: MP200816.

Techniques: Labeling, MANN-WHITNEY